Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
15th National Conference of the IAOMFP, Chennai, 2006
Abstract
Abstracts from current literature
Acne in India: Guidelines for management - IAA Consensus Document
Addendum
Announcement
Art & Psychiatry
Article
Articles
Association Activities
Association Notes
Award Article
Book Review
Brief Report
Case Analysis
Case Letter
Case Letters
Case Notes
Case Report
Case Reports
Clinical and Laboratory Investigations
Clinical Article
Clinical Studies
Clinical Study
Commentary
Conference Oration
Conference Summary
Continuing Medical Education
Correspondence
Corrigendum
Cosmetic Dermatology
Cosmetology
Current Best Evidence
Current Issue
Current View
Derma Quest
Dermato Surgery
Dermatopathology
Dermatosurgery Specials
Dispensing Pearl
Do you know?
Drug Dialogues
e-IJDVL
Editor Speaks
Editorial
Editorial Remarks
Editorial Report
Editorial Report - 2007
Editorial report for 2004-2005
Errata
Erratum
Focus
Fourth All India Conference Programme
From Our Book Shelf
From the Desk of Chief Editor
General
Get Set for Net
Get set for the net
Guest Article
Guest Editorial
History
How I Manage?
IADVL Announcement
IADVL Announcements
IJDVL Awards
IJDVL AWARDS 2015
IJDVL Awards 2018
IJDVL Awards 2019
IJDVL Awards 2020
IJDVL International Awards 2018
Images in Clinical Practice
In Memorium
Inaugural Address
Index
Knowledge From World Contemporaries
Leprosy Section
Letter in Response to Previous Publication
Letter to Editor
Letter to the Editor
Letter to the Editor - Case Letter
Letter to the Editor - Letter in Response to Published Article
LETTER TO THE EDITOR - LETTERS IN RESPONSE TO PUBLISHED ARTICLES
Letter to the Editor - Observation Letter
Letter to the Editor - Study Letter
Letter to the Editor - Therapy Letter
Letter to the Editor: Articles in Response to Previously Published Articles
Letters in Response to Previous Publication
Letters to the Editor
Letters to the Editor - Letter in Response to Previously Published Articles
Letters to the Editor: Case Letters
Letters to the Editor: Letters in Response to Previously Published Articles
Medicolegal Window
Messages
Miscellaneous Letter
Musings
Net Case
Net case report
Net Image
Net Images
Net Letter
Net Quiz
Net Study
New Preparations
News
News & Views
Obituary
Observation Letter
Observation Letters
Oration
Original Article
ORIGINAL CONTRIBUTION
Original Contributions
Pattern of Skin Diseases
Pearls
Pediatric Dermatology
Pediatric Rounds
Perspective
Presedential Address
Presidential Address
Presidents Remarks
Quiz
Recommendations
Regret
Report
Report of chief editor
Report of Hon : Treasurer IADVL
Report of Hon. General Secretary IADVL
Research Methdology
Research Methodology
Resident page
Resident's Page
Resident’s Page
Residents' Corner
Residents' Corner
Residents' Page
Retraction
Review
Review Article
Review Articles
Reviewers 2022
Revision Corner
Self Assessment Programme
SEMINAR
Seminar: Chronic Arsenicosis in India
Seminar: HIV Infection
Short Communication
Short Communications
Short Report
Snippets
Special Article
Specialty Interface
Studies
Study Letter
Study Letters
Supplement-Photoprotection
Supplement-Psoriasis
Symposium - Contact Dermatitis
Symposium - Lasers
Symposium - Pediatric Dermatoses
Symposium - Psoriasis
Symposium - Vesicobullous Disorders
SYMPOSIUM - VITILIGO
Symposium Aesthetic Surgery
Symposium Dermatopathology
Symposium-Hair Disorders
Symposium-Nails Part I
Symposium-Nails-Part II
Systematic Review and Meta-Analysis
Systematic Reviews and Meta-analyses
Systematic Reviews and Meta-analysis
Tables
Technology
Therapeutic Guideline-IADVL
Therapeutic Guidelines
Therapeutic Guidelines - IADVL
Therapeutics
Therapy
Therapy Letter
Therapy Letters
View Point
Viewpoint
What’s new in Dermatology
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
15th National Conference of the IAOMFP, Chennai, 2006
Abstract
Abstracts from current literature
Acne in India: Guidelines for management - IAA Consensus Document
Addendum
Announcement
Art & Psychiatry
Article
Articles
Association Activities
Association Notes
Award Article
Book Review
Brief Report
Case Analysis
Case Letter
Case Letters
Case Notes
Case Report
Case Reports
Clinical and Laboratory Investigations
Clinical Article
Clinical Studies
Clinical Study
Commentary
Conference Oration
Conference Summary
Continuing Medical Education
Correspondence
Corrigendum
Cosmetic Dermatology
Cosmetology
Current Best Evidence
Current Issue
Current View
Derma Quest
Dermato Surgery
Dermatopathology
Dermatosurgery Specials
Dispensing Pearl
Do you know?
Drug Dialogues
e-IJDVL
Editor Speaks
Editorial
Editorial Remarks
Editorial Report
Editorial Report - 2007
Editorial report for 2004-2005
Errata
Erratum
Focus
Fourth All India Conference Programme
From Our Book Shelf
From the Desk of Chief Editor
General
Get Set for Net
Get set for the net
Guest Article
Guest Editorial
History
How I Manage?
IADVL Announcement
IADVL Announcements
IJDVL Awards
IJDVL AWARDS 2015
IJDVL Awards 2018
IJDVL Awards 2019
IJDVL Awards 2020
IJDVL International Awards 2018
Images in Clinical Practice
In Memorium
Inaugural Address
Index
Knowledge From World Contemporaries
Leprosy Section
Letter in Response to Previous Publication
Letter to Editor
Letter to the Editor
Letter to the Editor - Case Letter
Letter to the Editor - Letter in Response to Published Article
LETTER TO THE EDITOR - LETTERS IN RESPONSE TO PUBLISHED ARTICLES
Letter to the Editor - Observation Letter
Letter to the Editor - Study Letter
Letter to the Editor - Therapy Letter
Letter to the Editor: Articles in Response to Previously Published Articles
Letters in Response to Previous Publication
Letters to the Editor
Letters to the Editor - Letter in Response to Previously Published Articles
Letters to the Editor: Case Letters
Letters to the Editor: Letters in Response to Previously Published Articles
Medicolegal Window
Messages
Miscellaneous Letter
Musings
Net Case
Net case report
Net Image
Net Images
Net Letter
Net Quiz
Net Study
New Preparations
News
News & Views
Obituary
Observation Letter
Observation Letters
Oration
Original Article
ORIGINAL CONTRIBUTION
Original Contributions
Pattern of Skin Diseases
Pearls
Pediatric Dermatology
Pediatric Rounds
Perspective
Presedential Address
Presidential Address
Presidents Remarks
Quiz
Recommendations
Regret
Report
Report of chief editor
Report of Hon : Treasurer IADVL
Report of Hon. General Secretary IADVL
Research Methdology
Research Methodology
Resident page
Resident's Page
Resident’s Page
Residents' Corner
Residents' Corner
Residents' Page
Retraction
Review
Review Article
Review Articles
Reviewers 2022
Revision Corner
Self Assessment Programme
SEMINAR
Seminar: Chronic Arsenicosis in India
Seminar: HIV Infection
Short Communication
Short Communications
Short Report
Snippets
Special Article
Specialty Interface
Studies
Study Letter
Study Letters
Supplement-Photoprotection
Supplement-Psoriasis
Symposium - Contact Dermatitis
Symposium - Lasers
Symposium - Pediatric Dermatoses
Symposium - Psoriasis
Symposium - Vesicobullous Disorders
SYMPOSIUM - VITILIGO
Symposium Aesthetic Surgery
Symposium Dermatopathology
Symposium-Hair Disorders
Symposium-Nails Part I
Symposium-Nails-Part II
Systematic Review and Meta-Analysis
Systematic Reviews and Meta-analyses
Systematic Reviews and Meta-analysis
Tables
Technology
Therapeutic Guideline-IADVL
Therapeutic Guidelines
Therapeutic Guidelines - IADVL
Therapeutics
Therapy
Therapy Letter
Therapy Letters
View Point
Viewpoint
What’s new in Dermatology
View/Download PDF

Translate this page into:

Brief Report
ARTICLE IN PRESS
doi:
10.25259/IJDVL_470_2023

Associations between interleukin-13, interleukin-4 and their receptor gene polymorphisms and susceptibility to atopic dermatitis in a Chinese Han population

Department of Dermatology, Xiamen Children’s Hospital (Children’s Hospital of Fudan University Xiamen Branch), Xiamen, Fujian, China
Corresponding author: Prof. Lian-Sheng Zhong, Department of Dermatology, Xiamen Children’s Hospital (Children’s Hospital of Fudan University Xiamen Branch), Xiamen, Fujian, China. 248694437@qq.com
Licence
This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-Share Alike 4.0 License, which allows others to remix, transform, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.

How to cite this article: Zhong LS, Chen XY, Xiao J. Associations between interleukin-13, interleukin-4 and their receptor gene polymorphisms and susceptibility to atopic dermatitis in a Chinese Han population. Indian J Dermatol Venereol Leprol. doi: 10.25259/IJDVL_470_2023

Abstract

Background

Atopic dermatitis (AD) is a common skin condition that occurs due to a combined effect of immune dysregulation, skin barrier dysfunction, changes in the cutaneous microbiome, and genetic factors. Recent data from both clinical trials and real-world studies indicate that dupilumab, a biological agent that inhibits interleukin 4 receptor-α is an effective drug in the treatment of AD, which further suggests the important role of IL-13 and IL-4 in the pathogenesis of AD.

Objectives

To assess the association between gene polymorphisms of IL-13, IL-13 receptor, IL-4, and IL-4 receptor and susceptibility to AD.

Methods

The single nucleotide polymorphisms (SNPs) of the above-mentioned genes were detected by single base extension (SNaPshot) assay. The association between these SNPs and AD risk was analysed using SPSS software.

Results

Two hundred and seventy-one subjects including 130 patients with AD and 141 healthy controls were enrolled. There were statistical differences between AD patients and controls in genotype distribution at rs2265753, rs6646259, and rs2254672 of the IL-13 receptor gene (P all < 0.001). Subjects with CG at rs2265753, AG at rs6646259 and TG at rs2254672 had increased risks for AD (P all < 0.001), and subjects with GG at rs2265753, rs6646259, and rs2254672 had reduced risks for AD (P all < 0.001).

Limitation

This was a single-centre and single-race study, with a relatively small sample size.

Conclusions

Findings from this study show that rs2265753, rs6646259 and rs2254672 of the IL-13 receptor gene are associated with susceptibility to AD.

Keywords

Atopic dermatitis
IL-14
IL-13
single nucleotide polymorphism
receptor

Introduction

Atopic dermatitis (AD) is a common skin disease that usually begins during infancy. The lesions of AD are characterised by pruritic erythematous, papules, papulovesicles, and lichenification which may become excoriated and tend to have a flexural distribution such as the neck, cubital fossa, and popliteal fossa. AD generally occurs due to a combined effect of immune dysregulation, skin barrier dysfunction, alterations in the skin bacterial microbiome, and genetic factors.1 Genetic factors are very important in the pathogenesis of AD, which is supported by the facts that the concordance rate for AD is much higher in identical twins than in fraternal twins,2 AD patients or their first-degree relatives often have a history of atopic diseases, such as AD, allergic rhinitis, allergic conjunctivitis, asthma, food allergy, and eosinophilic esophagitis. Recent studies have shown that more than 70 genes may be related to the pathogenesis of AD.3

Recent data from both clinical trials and real-world studies indicate that dupilumab, a biological agent targeting interleukin 4 receptor-α is a very effective drug for the treatment of AD, emphasising the role of IL-13 and IL-4 in the pathogenesis.4 The objective of this study was to evaluate the association between IL-13, IL-4, and their receptor gene polymorphisms and the susceptibility to AD in a Chinese Han population.

Methods

Study population

The required sample size was calculated using the Raosoft sample size calculator,5 based on a significance level of 5%, confidence interval of 90%, population size of 2,00,000, and the prevalence of each mutation [Table 1]. Inclusion criteria were a confirmed diagnosis of AD based on Hanifin and Rajka criteria, absence of other skin diseases, and Chinese Han ethnicity. Patients with mixed ethnicities were excluded. All patients were enrolled from October 2021 to July 2022 in Xiamen Children’s Hospital. Healthy controls were enrolled from children undergoing a routine physical examination in the same hospital, and all of them had no personal and/or family history of AD, allergic rhinitis, asthma, and other allergic diseases based on the questionnaire and previous diagnoses. The study was approved by the Ethics Committee of Xiamen Children’s Hospital (Approval no. [2022]04) and all patients and controls signed informed consent before data collection.

Table 1: The required sample size calculated using Raosoft sample size calculator
SNP Minor allele Minor allele frequency Sample size required
rs30913076 G 0.213 182
rs22546726 G 0.407 261
rs22657536 G 0.408 262
rs205416 A 0.360 250
rs18009257 T 0.215 183
rs22432508 T 0.165 149
rs22272848 T 0.341 243
rs18050118 C 0.173 155
rs18012759 G 0.188 166
rs18050109 G 0.500 271
rs6646259 A 0.500* 271
rs2243274 G 0.500* 271
We used 50% because there is no data available on atopic dermatitis (AD) patients.

Primer design, data collection, and genotyping

Blood was collected from each patient and control and immediately stored at –80°C. We searched the website of The National Center for Biotechnology Information (NCBI) to identify Single Nucleotide Polymorphisms (SNPs) in IL-13, IL-4, and their receptor genes, reviewed relevant literature, and in total choose 12 SNPs from the four genes as listed, IL-13 -rs3091307, rs2054, and rs1800925, IL-13 receptor - rs2265753, rs6646259 and rs2254672, IL-4 - rs2243250, rs2227284 and rs2243274 and IL-4 receptor - rs1801275, rs1805010 and rs1805011. Genotypes of samples were detected by SNaPshot assay, polymerase chain reaction (PCR) primers used for amplification, and minisequencing primers used for SNaPshot reactions of the 12 gene regions as shown in Table 2.

Table 2: PCR primers used for the amplification and minisequencing primers used for the SNaPshot reactions of the 12 gene regions
PCR primers used for the amplification of the 12 gene regions
Genes SNPs Primer sequence Product (bp)
IL-4 rs2243250

F: AAGGGCTTCCTTATGGGTAAGG

R:GCATCTTGGAAACTGTCCTGTC

208
rs2227284 F:CTGTCTGAGGAACAGCAAAGTG R:GAACTGCTTAGGGAGTGACTCA 386
rs2243274

F:AAGGAGATTCTCACTCCGCATC

R:TCTCAGTCAGGTTCTGCTCTTG

345
IL-13 rs3091307

F:AGATACAGAGGTGTTATAGTG

R:AGTTCCTGAGCATTCTTG

343
rs20541

F:CTTCCGTGAGGACTGAATGAGA

R:CACAGGCTGAGGTCTAAGCTAA

360
rs1800925

F:TGGGTAGGGGAGAAATCTTGAC

R:ACGTGTCTGGCCCCTTTAAT

360
IL-4R rs1805010

F:ATCTGTCCTCACATCCGTGATC

R:CTTCCTCCTGCTGTTGCTATGA

393
rs1805011

F:AGATCAGCAAGACAGTCCTCTG

R:AGGAACAGGCTCTCTGTTAGC

202
rs1801275

F:AGAGTCCAGACAACCTGACTTG

R:CTTGAGAAGGCCTTGTAACCAG

394
IL-13R rs2265753

F:CATTTGAGGAGAGACTCCCAGT

R:CCAAGTCAGTTCTTCACTCAGC

329
rs6646259

F:AGCCTGGACCTCTATTACTCCT

R:TCGTTGAAGAGGCTGTTGGT

356
rs2254672

F:GTCATCATTCCCTTCGACAGC

R:GGCCTAGCACAAACCAAAGAC

257
Minisequencing primers used for the SNaPshot reactions of the 12 gene regions
Genes SNPs Primer sequence
IL-4 rs2243250 TTTTTTTTTTTTTTTTTTTTTTTTTTCACCTAAACTTGGGAGAACATTGT
rs2227284 TTTTTTTTTTTAGCTCTCTTTGGTAAATAGGAAAT
rs2243274 TTTTTTTTTTTTTTTTAAAATGTCTTAGCTCCTCACTTGG
IL-13 rs3091307 TTTTTTTTTTTTTTTTTTTTGTTTGTGTTTATTCCATTGTTTTCA
rs20541 TTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTTTCGAAGTTTCAGTTGAAC
rs1800925 TTTTTTTTTTTTTTTTTTTTCCTTTTCCTGCTCTTCCCTC
IL-4R rs1805010 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTCCGTTGTTCTCAGGGA
rs1805011 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGACTTCCAGGAGGGAAGGG
rs1801275 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCCCACCAGTGGCTATC
IL-13R rs2265753 TTTTTTTTTTTTTTTTTTTTTTTTTTTTGCCATGGCCTGCGTGAT
rs6646259 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTTGTCGCGGACACTCCATA
rs2254672 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCACTGCCCCTAACAGCCTA

Note: A-adenine, C-cytosine, T-thymine and G-guanine.

Statistical analysis

SPSS 21.0 software was applied to analyse all the experimental data. The age of the patients and controls were analysed by Student’s t-test. The gender of the two groups and the deviation of Hardy–Weinberg equilibrium (HWE) were analysed by the chi-square test. Differences in allelic frequency and genotypic distribution including dominant, codominant, over dominant, and recessive genetic models between AD patients and healthy controls were evaluated using logistic regression analyses, and the odd ratios (OR) with the 95% confidence interval (95% CI) were obtained accordingly.

Results

We enrolled 130 patients with AD (64 males and 66 females, mean age 39.74 ± 31.49 months) and 141 healthy controls (72 males and 69 females, mean age 41.45 ± 29.68 months) less than 18 years of age. No significant differences were observed concerning gender and age between patients and controls (P > 0.05). All 271 samples were successfully genotyped for the selected 12 SNPs, and they did not deviate from the distribution of Hardy–Weinberg equilibrium [Table 3]. Representative electropherograms of the 12 SNPs are shown in Figure 1. Table 3 lists the minor allele frequency of the 12 SNPs with a 95% CI level. Table 4 lists the allele and genotype frequencies of the 12 SNPs in the AD patient group and the control group. There were no statistically significant differences between AD patients and controls in genotype and allele frequencies at SNPs of IL-13, IL-4, and IL-4 receptor genes. There were no statistically significant differences between AD patients and controls in allele frequencies at SNPs of the IL-13 receptor gene. There were statistically significant differences between AD patients and controls in genotype distribution at rs2265753, rs6646259, and rs2254672 of the IL-13 receptor gene (P all < 0.001). Subjects with CG at rs2265753, AG at rs6646259, and TG at rs2254672 had increased risks for AD (P all < 0.001), and subjects with GG at rs2265753, rs6646259, and rs2254672 had reduced risks for AD (P all < 0.001).

Table 3: Hardy–Weinberg equilibrium test and minor allele frequency with 95% CI level of the 12 SNPs
Hardy–Weinberg equilibrium test
Minor allele frequency with 95% CI
SNPs Genotype distribution χ2 P Minor allele Minor allele frequency 95% CI
rs2265753 CC CG GG 4.08 0.13 G 0.446 0.385–0.507
48 48 34
rs6646259 AA AG GG 3.19 0.20 G 0.419 0.359–0.480
51 49 30
rs2254672 TT TG GG 4.97 0.08 G 0.423 0.363–0.484
52 46 32
rs3091307 AA AG GG 2.94 0.23 G 0.219 0.169–0.270
75 53 2
rs20541 GG AG AA 1.19 0.55 A 0.362 0.303–0.420
49 68 13
rs1800925 CC CT TT 0.63 0.73 T 0.188 0.141–0.236
84 43 3
rs2243250 TT CT CC 0.01 1.00 C 0.185 0.137–0.232
86 40 4
rs2227284 TT GT GG 0.27 0.87 G 0.131 0.090–0.172
99 28 3
rs2243274 AA AG GG 0.00 1.00 G 0.192 0.144–0.241
85 40 5
rs1801275 AA GA GG 0.24 0.89 G 0.169 0.123–0.215
91 34 5
rs1805010 GG GA AA 0.88 0.65 A 0.477 0.416–0.538
32 72 26
rs1805011 AA CA CC 0.25 0.99 C 0.073 0.041–0.105
112 17 1
Figure 1:
Representative electropherograms of the 12 Single Nucleotide Polymorphisms (SNPs). Peaks of different colors indicates different alleles (Blue peak: G; Black peak: C; Green peak: A; Red peak: T). The overlapping peaks at rs 2254672 means alleles C and A at the same site but in different color.
Table 4: Genotypes and alleles frequencies of the 12 SNPs in AD patients and normal controls
SNP Genetic model Genotype/allele Patients N = 130(%) Controls N = 141(%) Logistic regression
OR (95% CI) P value
IL-13R
rs2265753 Codominant CC 48 (36.9) 62 (44) 1 <0.001
CG 48 (36.9) 14 (9.9) 0.226 (0.112–0.457))
GG 34 (26.2) 65 (46.1) 1.480 (0.845–2.592)
Dominant CC 48 (36.9) 62 (44) 1 0.238
CG+GG 82 (63.1) 79 (65.1) 0.746(0.458–1.214)
Recessive CC+CG 96 (73.8) 76 (53.9) 1 0.001
GG 34 (26.2) 65 (46.1) 2.415 (1.447–4.031)
Over dominant CC+GG 82 (63.1) 127 (90.1) 1 <0.001
CG 48 (36.9) 14 (9.9) 0.188 (0.098–0.363)
Alleles C 144 (55.4) 138 (48.9) 1 0.133
G 116 (44.6) 144 (51.1) 1.295 (0.924–1.186)
rs6646259 Codominant AA 51 (39.2) 66 (48.8) 1 <0.001
AG 49 (37.7) 13 (9.2) 0.205 (0.101–0.418)
GG 30 (23.1) 62 (44.0) 1.597 (0.904–2.820)
Dominant AA 51 (39.2) 66 (48.8) 1 0.208
AG+GG 79 (60.8) 75 (53.2) 0.734 (0.453–1.189)
Recessive AA+AG 100 (76.9) 79 (56.0) 1 <0.001
GG 30 (23.1) 62 (44.0) 2.616 (1.545–4.428)
Over dominant AA+GG 81 (62.3) 128 (90.1) 1 <0.001
AG 49 (37.7) 13 (9.1) 0.168 (0.086–0.329)
Alleles A 151 (58.1) 145 (51.4) 1 0.120
G 109 (41.9) 137 (48.6) 1.309 (0.932–1.838)
rs2254672 Codominant TT 52 (40) 63 (44.7) 1 <0.001
TG 46 (35.4) 13 (9.2) 0.233 (0.114–0.478)
GG 32 (24.6) 65 (46.1) 1.677 (0.957–2.936)
Dominant TT 52 (40) 63 (44.7) 1 0.436
TG+GG 78 (60.0) 78 (55.3) 0.825 (0.509–1.338)
Recessive TT+TG 98 (75.4) 76 (57.6) 1 <0.001
GG 32 (24.6) 65 (42.4) 2.619 (1.559-–4.339)
Over dominant TT+GG 84 (64.6) 128 (90.8) 1 <0.001
TG 46 (35.4) 13 (9.2) 0.185 (0.094–0.364)
Alleles T 150 (57.7) 139 (49.3) 1 0.050
G 110 (42.3) 143 (50.7) 1.403 (0.999–1.969)
IL-13
rs3091307 Codominant AA 75 (57.7) 91 (64.5) 1 0.139
AG 53 (40.8) 44 (31.2) 0.684 (0.414–1.132)
GG 2 (1.5) 6 (4.3) 2.473 (0.485–12.610)
Dominant AA 75 (57.7) 91 (64.5) 1 0.248
AG+GG 55 (42.3) 50 (35.5) 0.749 (0.459–1.223)
Recessive AA+AG 128 (98.5) 135 (95.7) 1 0.176
GG 2 (1.5) 6 (4.3) 2.844 (0.564–14.351)
Over dominant AA+GG 77 (59.2) 97 (68.8) 1 0.101
AG 53 (40.8) 44 (31.2) 0.659 (0.400–1.086)
Alleles A 203 (78.1) 226 (80.1) 1 0.555
G 57 (21.9) 56 (19.9) 0.882 (0.583–1.336)
rs20541 Codominant GG 49 (37.7) 64 (45.4) 1 0.434
AG 68 (52.3) 64 (45.4) 0.721 (0.435–1.194)
AA 13 (10.0) 13 (9.2) 0766 (0.326–1.799)
Dominant GG 49 (37.7) 64 (45.4) 1 0.199
AG+AA 81 (62.3) 77 (54.6) 0.728 (0.448–1.183)
Recessive GG+AG 117 (90.0) 128 (90.8) 1 0.828
AA 13 (10.0) 13 (9.2) 0.914 (0.407–2.052)
Over dominant AA+GG 62 (47.7) 77 (54.6) 1 0.255
AG 68 (52.3) 64 (45.4) 0.758 (0.470–1.222)
Alleles A 94 (36.2) 90 (31.9) 1 0.298
G 166 (63.8) 192 (68.1) 1.208 (0.846–1.725)
rs1800925 Codominant CC 84 (64.6) 94 (66.7) 1 0.938
CT 43 (33.1) 44 (31.2) 0.914 (0.547–1.527)
TT 3 (2.3) 3 (2.1) 0.894 (0.176–4.548)
Dominant CC 84 (64.6) 94 (66.7) 1 0.722
CT+TT 46 (35.4) 47 (33.3) 0.913 (0.553–1.508)
Recessive CC+CT 127 (97.7) 138 (97.9) 1 0.920
TT 3 (2.3) 3 (2.1) 0.920 (0.182–4.643)
Over dominant CC+TT 87 (66.9) 97 (68.8) 1 0.742
CT 43 (33.1) 44 (31.2) 0.918 (0.551–1.529)
aAlleles C 211 (81.2) 232 (82.3) 1 0.737
T 49 (18.8) 50 (17.7) 0.928 (0.600–1.435)
IL-4
rs2243250 Codominant TT 86 (66.1) 91 (64.5) 1 0.818
CT 40 (30.8) 45 (31.9) 1.063 (0.633–1.785)
CC 4 (3.1) 5 (3.6) 1.575 (0.365–6.792)
Dominant TT 86 (66.1) 91 (64.5) 1 0.780
CT+CC 44 (33.9) 50 (35.5) 1.074 (0.651–1.772)
Recessive TT+CT 126 (96.9) 136 (96.4) 1 0.830
CC 4 (3.1) 5 (3.6) 1.158 (0.304–4.409)
Over dominant CC+TT 90 (69.2) 96 (68.1) 1 0.839
CT 40 (30.8) 45 (31.9) 1.055 (0.631–1.763)
Alleles C 48 (18.5) 55 (19.5) 1 0.757
T 212 (81.5) 227 (80.5) 0.934 (0.608–1.437)
rs2227284 Codominant TT 99 (76.2) 115 (81.6) 1 0.382
GT 28 (21.5) 25 (17.7) 0.769 (0.421–1.404)
GG 3 (2.3) 1 (0.7) 0.287 (0.029–2.803)
Dominant TT 99 (76.2) 115 (81.6) 1 0.275
GT+GG 31 (23.8) 26 (18.4) 0.722 (0.402–1.298)
Recessive GG 3 (2.3) 1 (0.7) 1 0.276
GT+TT 127 (97.7) 140 (99.3) 3.307 (0.340–32.199)
Over dominant GG+TT 102 (78.5) 116 (82.3) 1 0.430
GT 28 (21.5) 25 (17.7) 0.785 (0.430–1.432)
Alleles T 226 (86.9) 255 (90.4) 1 0.197
G 34 (13.1) 27 (9.6) 0.704 (0.412–1.203)
rs2243274 Codominant AA 85 (65.4) 89 (63.1) 1 0.872
AG 40 (30.8) 45 (31.9) 1.074 (0.639–1.806)
GG 5 (3.8) 7 (5.0) 1.337 (0.409–4.375)
Dominant AA 85 (65.4) 89 (63.1) 1 0.698
AG+GG 45 (34.6) 52 (39.9) 1.104 (0.671–1.815)
Recessive GG 5 (3.8) 7 (5.0) 1 0.655
AG+AA 125 (96.2) 134 (95.0) 0.766 (0.237–2.475)
Over dominant AA+GG 90 (69.2) 96 (68.1) 1 0.568
AG 40 (30.8) 45 (31.9) 1.160 (0.697–1.932)
Alleles A 210 (80.8) 223 (79.1) 1 0.624
G 50 (19.2) 59 (20.9) 1.111 (0.729–1.693)
IL-4R
rs1801275 Codominant AA 91 (70.0) 103 (73.1) 1 0.440
GA 34 (26.2) 36 (25.5) 0.935 (0.541–1.617)
GG 5 (3.8) 2 (1.4) 0.353 (0.067–1.866)
Dominant AA 91 (70.0) 103 (73.1) 1 0.578
GA+GG 39 (30) 38 (26.9) 0.861 (0.508–1.460)
Recessive GG 5 (3.8) 2 (1.4) 1 0.208
GA+AA 125 (96.2) 139 (98.6) 2.780 (0.530–14.585)
Over dominant AA+GG 96 (73.8) 105 (74.5) 1 0.907
GA 34 (26.2) 36 (25.5) 0.968 (0.562–1.668)
Alleles A 216 (83.1) 242 (85.8) 1 0.379
G 44 (16.9) 40 (14.2) 0.811 (0.509–1.293)
rs1805010 Codominant GG 32 (24.6) 33 (23.4) 1 0.473
GA 72 (55.4) 71 (50.4) 0.956 (0.532–1.719)
AA 26 (20.0) 37 (26.2) 1.380 (0.686–2.775)
Dominant GG 32 (24.6) 33 (23.4) 1 0.816
GA+AA 98 (75.4) 108 (76.6) 1.069(0.612–1.867)
Recessive AA 26 (20.0) 37 (26.2) 1 0.224
GA+GG 104 (80.0) 104 (73.8) 0.703 (0.397–1.243)
Over dominant GG+AA 58 (44.6) 70 (49.6) 1 0.407
GA 72 (55.4) 71 (50.4) 0.817 (0.507–1.318)
Alleles G 136 (52.3) 137 (48.6) 1 0.386
A 124 (47.7) 145 (51.4) 1.161 (0.828–1.626)
rs1805011 Codominant AA 112 (86.2) 120 (85.8) 1 0.964
CA 17 (13.1) 20 (14.2) 1.098 (0.547–2.202)
CC 1 (0.7) 1 (0.0) 0.933 (0.058–15.101)
Dominant AA 112 (86.2) 120 (85.8) 1 0.806
CA+CC 18 (13.8) 21 (14.2) 1.089 (0.552–2.150)
Recessive CC 1 (0.7) 1 (0.0) 1 0.954
CA+AA 129 (99.3) 140 (100.0) 1.085 (0.067–17.530)
Over dominant AA+CC 113 (86.9) 121 (85.8) 1 0.791
CA 17 (13.1) 20 (14.2) 1.099 (0.548–2.203)
Alleles A 241 (92.7) 260 (92.9) 1 0.828
C 19 (7.3) 22 (7.1) 1.073 (0.567–2.032)

Discussion

As most patients with AD have eosinophilia and elevated serum total IgE, AD is currently considered to be a Th2 cells-mediated inflammatory disease. In the Th2 inflammatory process of AD, Th2 cells-derived cytokines, especially IL-4 and IL-13 play a crucial role because both can stimulate eosinophil recruitment and IgE production, and contribute to decreased antimicrobial peptide production, increase keratinocyte proliferation and impairment of skin barrier function.10

In most patients with AD, the serum total IgE level is significantly elevated. Therefore, IL-4 has long been considered the most critical cytokine involved in the pathogenesis of AD, because it plays a crucial role in the regulation of IgE synthesis. However, in recent years, strong evidence has shown that IL-13 is more important than IL-4 in AD inflammation.1113

In recent years, advances in biologics also suggest that IL-13 plays a more important role than IL-4 in the pathogenesis of AD. As mentioned above, clinical and real-world data indicate that dupilumab which blocks the biological functions of both IL-4 and IL-13 has shown very good efficacy in the treatment of AD.4 Lebrikizumab and tralokinumab which blocks the biological function of IL-13 alone, have also shown promising efficacy in the treatment of AD,14,15 and tralokinumab has been approved by FDA for the treatment of moderate to severe AD in 2022.16 However, till date there is no evidence to prove that a biological agent that exclusively blocks IL-4 is effective in the treatment of AD.

In recent years, studies have increasingly focused on the relationship between genetic factors and susceptibility to AD. These studies have shown that more than 70 genes could be involved in the pathogenesis of AD, especially the filaggrin gene.3 Because IL-13 plays a crucial role in the pathogenesis of AD, the polymorphism of IL-13 and its receptor genes could be associated with the genetic susceptibility and severity of AD. In recent years, many researchers have shown that the SNPs of the IL-13 gene, such as rs20541, rs1800925, rs3091307, and rs1295685 are associated with AD. The association between rs20541 and AD susceptibility and total serum IgE level in a German population was reported by Liu et al.17 Lee et al. reported that rs20541 and rs1295685 of the IL-13 gene showed significant associations with AD risk and the total serum IgE level.7 The frequency of allele and genotypes of rs1800925 was found to be associated with the incidence and severity of AD, and total serum IgE level in Polish patients in the research of Gleń et al.18 In a research by Namkung et al., there were significant differences in the genotypic and allelic distributions of rs20541, rs3091307, rs2254672 and rs2265753 between AD patients and normal controls in a Korean population.6 In recent years, many studies have also shown that gene polymorphisms of IL-4 and IL-4 receptor are also related to AD susceptibilities, such as rs2243250, rs2243248, rs2243274 and rs2227284 of IL-4,1921 and rs1805015, rs1805010, rs1805011 and rs1801275 of IL-4R.2225

Limitations

This was a single-centre and single-race study with a small sample size. We did not apply the Bonferroni correction in the present study to control the multiple comparisons.

Conclusions

This study researched the association between the polymorphism of IL-4 and IL-13, and their receptor genes, and the genetic susceptibility of AD patients in a Chinese Han Population. The results suggested that the rs2265753, rs6646259, and rs2254672 of the IL-13 receptor gene are associated with susceptibility to AD. Subjects with CG at rs2265753, AG at rs6646259, and TG at rs2254672 had increased risks for AD, while patients with GG at rs2265753, rs6646259 and rs2254672 showed a protective effect. These findings may have a role in the development of future precision therapy and targeted drugs in the treatment of AD. Other functional SNPs of the IL-13 receptor gene need to be explored. Large-scale, multi-centric studies including patients from different ethnicities are required to further clarify the role of the IL-13 receptor gene in the pathogenesis of AD.

Acknowledgements

Nil.

Ethical approval

This research/study is approved by the Institutional Review Board at the Ethics Committee of Xiamen Children’s Hospital, number [2022]04, dated 12 May 2021.

Declaration of patient consent

The authors certify that they have obtained all appropriate patient consent.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

Use of artificial intelligence (AI)-assisted technology for manuscript preparation

The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.

References

  1. , , , , , . Update on atopic dermatitis. Acta Med Port. 2019;32:606-13.
    [CrossRef] [PubMed] [Google Scholar]
  2. , , , , , . Importance of genetic factors in the etiology of atopic dermatitis: A twin study. Allergy Asthma Proc. 2007;28:535-9.
    [CrossRef] [PubMed] [Google Scholar]
  3. , , , , , . Genetic and epigenetic aspects of atopic dermatitis. Int J Mol Sci. 2020;21:6484.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  4. , , , , , . The efficacy and safety of dupilumab in Chinese patients with moderate-to-severe atopic dermatitis: A randomized, double-blind, placebo-controlled study. Br J Dermatol. 2022;186:633-41.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  5. . Available from: http://www.raosoft.com/samplesize.html
  6. , , , , , . Association of polymorphisms in genes encoding IL-4, IL-13 and their receptors with atopic dermatitis in a Korean population. Exp Dermatol. 2011;20:915-19.
    [CrossRef] [PubMed] [Google Scholar]
  7. , , , , , . Association of IL13 genetic polymorphisms with atopic dermatitis: Fine mapping and haplotype analysis. Ann Allergy Asthma Immunol. 2020;125:287-93.
    [CrossRef] [PubMed] [Google Scholar]
  8. , , , , , . Polymorphisms in the interleukin 4, interleukin 4 receptor and interleukin 13 genes and allergic phenotype: A case control study. Adv Med Sci. 2016;61:40-5.
    [CrossRef] [PubMed] [Google Scholar]
  9. , , , , , . Interaction between antibiotic use and MS4A2 gene polymorphism on childhood eczema: A prospective birth cohort study. BMC Pediatr. 2021;14:314.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  10. , , , , , . An integrated model of atopic dermatitis biomarkers highlights the systemic nature of the disease. J Invest Dermatol. 2017;137:603-13.
    [CrossRef] [PubMed] [Google Scholar]
  11. , , , , , . Cytokine profiles in interstitial fluid from chronic atopic dermatitis skin. J Eur Acad Dermatol Venereol. 2015;29:2136-44.
    [CrossRef] [PubMed] [Google Scholar]
  12. , , , . Relative importance of IL-4 and IL-13 in lesional skin of atopic dermatitis. Arch Dermatol Res. 2004;295:459-64.
    [CrossRef] [PubMed] [Google Scholar]
  13. , , , , , . Atopic dermatitis is an IL-13-dominant disease with greater molecular heterogeneity compared to psoriasis. J Invest Dermatol. 2019;139:1480-9.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  14. , , , , , . Efficacy and safety of lebrikizumab, a high-affinity interleukin 13 inhibitor, in adults with moderate to severe atopic dermatitis: A phase 2b randomized clinical trial. JAMA Dermatol. 2020;156:411-20.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  15. , , , , , . Tralokinumab plus topical corticosteroids for the treatment of moderate-to -severe atopic dermatitis: Results from the double-blind, randomized, multicentre, placebo-controlled phase III ECZTRA 3 trial. Br J Dermatol. 2021;184:450-63.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  16. , , , , , . The efficacy and safety of IL-13 inhibitors in atopic dermatitis: A systematic review and meta-analysis. Front Immunol. 2022;13:923362.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  17. , , , , , . An IL13 coding region variant is associated with a high total serum IgE level and atopic dermatitis in the German multicenter atopy study (MAS-90) J Allergy Clin Immunol. 2000;106:167-70.
    [CrossRef] [PubMed] [Google Scholar]
  18. , , , , , . Interleukin-13 promoter gene polymorphism -1112 C/T is associated with atopic dermatitis in Polish patients. Acta Dermatovenerol Croat. 2012;20:231-8.
    [PubMed] [Google Scholar]
  19. , , , , . IL-4 gene polymorphism may contribute to an increased risk of atopic dermatitis in children. Dis Markers. 2016;2016:1021942.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  20. , , , , , . Interleukin 4 -590C/T (rs2243250) polymorphism is associated with increased risk of atopic dermatitis: Meta-analysis of case-control studies. Dermatitis. 2017;28:144-151.
    [CrossRef] [PubMed] [Google Scholar]
  21. , , , . Gene polymorphisms of 22 cytokines in Macedonian children with atopic dermatitis. Iran J Allergy Asthma Immunol. 2012;11:37-50.
    [PubMed] [Google Scholar]
  22. , , , , , . Gene polymorphism of interleukin-4, interleukin-4 receptor and STAT6 in children with atopic dermatitis in Taif, Saudi Arabia. Immunol Invest. 2016;45:223-34.
    [CrossRef] [PubMed] [Google Scholar]
  23. , , , , . Association analysis of non-synonymous polymorphisms of interleukin-4 receptor-α and interleukin-13 genes in canine atopic dermatitis. J Vet Med Sci. 2020;82:1253-9.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  24. , , . Interleukin 4 receptor alpha chain polymorphism Gln551Arg is associated with adult atopic dermatitis in Japan. Br J Dermatol. 2000;142:1003-6.
    [CrossRef] [PubMed] [Google Scholar]
  25. , , . Case-control study of eczema in relation to IL4Rα genetic polymorphisms in Japanese women: The Kyushu Okinawa maternal and child health study. Scand J Immunol. 2013;77:413-18.
    [CrossRef] [PubMed] [Google Scholar]
Show Sections